ChristiansUnite Forums
May 05, 2026, 10:14:41 AM *
Welcome, Guest. Please login or register.

Login with username, password and session length
News: Our Lord Jesus Christ loves you.
 
   Home   Help Search Login Register  
Pages: 1 ... 51 52 [53] 54 55 ... 85   Go Down
  Print  
Author Topic: Biblical Creation vs. Evolution  (Read 749582 times)
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #780 on: March 01, 2007, 04:37:39 AM »

 Space Travel? Shields UP!
by David F. Coppedge*

In this unique era of human history, manned space flight -- the dream of many a novelist -- has become routine. Star Trek and its spin-offs have taken our imaginations far beyond our giant leap to the moon. Is the sky the limit?

Most manned space flight has been in the relatively safe zone of low earth orbit. The president's "Moon, Mars and Beyond" initiative, however, is forcing physiologists to consider the hazards of prolonged exposure to space. The news is not good. Earthlings, count your blessings.

Outer space is no calm vacuum. It is filled with fast-moving particles, from the smallest neutrinos to massive meteoroids. The solar wind blows electrons and protons at over a million mph. Without warning, solar flares can erupt, emitting 100 times the sun's normal X-ray energy output. In addition, high-energy cosmic rays from deep space can easily penetrate a spaceship and a human body, causing cumulative damage to tissues and DNA.

Shuttle and space station astronauts operate within Earth's protective Van Allen belts and gravitational field. So far, only the Apollo astronauts have ventured outside our safe bubble into the cosmic shooting gallery. The longest mission, Apollo 17, lasted only 12 days. Fortunately, none of the flights occurred during a solar flare. Had the space travelers received such a blast, they would have been dead within minutes.

This is just one of many risks that future Mars astronauts would face on a three-year mission. Last September, NASA medical researchers described "Risk 29": the cumulative damage from cosmic rays. A press release warned, "massive amounts of solar and cosmic radiation will decimate the brains of astronauts, leaving them in a vegetative state, if they survive at all." The sight of a demented crew emerging from their craft is hardly the photo-op to boost national pride.

Unlike Earth, Mars has no global magnetic field. The night side could offer shielding from the sun, but astronauts would have to live underground to avoid cosmic rays. But in some ways, solid shielding is worse than none at all. High-energy particles impacting a barrier generate showers of secondary particles, causing even more damage. The best shields are not practical: walls two feet thick filled with hydrogen.

Even if these show-stoppers are overcome, Mars is no place for playful romps. Dust devils meandering over the ultra-dry surface generate highly oxidizing compounds, blanketing the soil with toxic chemicals and charging the dust with static electricity. Fine dust would get into everything, irritating moist membranes and damaging equipment (see Astronomy, March 2006). Mars probably smells awful, too, and the atmosphere is so thin, nobody could hear you scream.

We wish the best to future Mars astronauts. Humans are creative problem-solvers, and with some luck (avoiding solar flares and meteoroids on the trip), one day we may welcome home the first Mars astronauts with a ticker-tape parade on Broadway. In the meantime, step outside underneath the gentle sun, breathe the sweet air, and thank God.

*David F. Coppedge works in the Cassini program at the Jet Propulsion Laboratory.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #781 on: March 01, 2007, 04:38:43 AM »

 The Code of Life: Little Words, Big Message
by Daniel Criswell, Ph.D.*

Most of us are impressed with the apparent intelligence of those who use big words in speeches or conversation. Even more impressive are those who actually know what these words mean, how to use them, and how to spell them! On the other hand, no one is ever going to accuse Huck Finn or Tom Sawyer of Ivy League intelligence based on their pronunciation and use of the "English" language. Any politician will confess that speeches frequently interspersed with "words" such as, "yes'm," "an'um," and "duh," are not likely to capture the confidence of potential voters. Unless, of course, the speaker is someone as clever as Mark Twain could be with a pen.

By using slang and colloquial expressions, Twain demonstrated that the choice of words can communicate several levels of information about a character. Similarly the "words" that comprise the code of life (the genetic code) also communicate several levels of information. The "words" of the genetic code form "sentences" called genes. The genes are poly-functional, able to produce more than one protein, depending on which direction the gene (sentence) is read, or where the gene starts and stops (Sanford 2005). In addition to coding for the correct protein, the letters that comprise the genetic code are organized in a way that minimizes errors in protein sequence and structure (Archetti 2004), helps to regulate the amount of protein produced by the cell (Archetti 2004; Ikemura 1985; Chamary and Hurst 2005), and possibly assist proteins in folding into the correct functional shape (Quinn 1975; Kimchi-Sarfaty et al. 2006, see endnote).

Many of us have watched enough television, or at least remember enough of our high school biology, to know that the substance with the information to form life has one of those big impressive names -- deoxyribonucleic acid, or DNA for those of us who prefer Tom Sawyer. DNA is the source of the three letter words that determine what the life form will be and how it functions. The genetic code words are made from just four letters, A, C, G, and T, which correspond to the four nitrogenous bases, adenine, cytosine, guanine, and thymine. Because there are three letters in each code word and only four letters to choose from, the genetic code has just 64 (43) words. Sixty-four words to spell out the information necessary to make all the forms of life on our planet!

How does this code work and how does this information indicate there must be a Creator responsible for it? Even an introductory investigation of the genetic code reveals several levels of information that must have come from an intelligent source. How the genetic code is translated into functional proteins that make life possible is similar to how an architect produces a blueprint of a house and then has someone deliver it to a contractor who builds the house. In a cell, DNA would be the blueprint; a similar nucleic acid, messenger RNA (mRNA) would be the messenger; and the cellular machinery for protein synthesis would be the contractor and his workers. In DNA, the four bases, A, C, G, and T, are arranged in a long chain or polymer to provide the blueprint for building a specific house, or make that protein. These letters are arranged in a chain with two strands forming a double-stranded molecule. One strand has the coding information and the complementary strand is used as a template to correct damage (mutations) to the coding strand.

    DNA Coding Sequence                  GAGTAGCAGTCCCCACCTTGACGC
    DNA Complementary Sequence     CTCATCGTCAGGGGTGGAACTGCG

Notice that G pairs with C, and A pairs with T in the double-stranded DNA molecule. This complementary base pairing facilitates the transcription of a message from DNA to the cellular machinery through mRNA. To write a message to the protein synthesis machinery (the contractor) in the cell, the two DNA strands separate, and enzymes (proteins) construct a complementary mRNA strand, which differs from DNA by having a different base, U (uracil), in place of T (thymine).

    DNA Coding Sequence                 GAG-TAG-CAG-TCC-CCA-CCT-TGA-CGC
    mRNA                                         CUC-AUC-GUC-AGG-GGU-GGA-ACU-GCG

The sequences are segmented in this example to show the three letter "words" in the mRNA called codons that are responsible for taking the genetic code to the protein synthesis machinery in the cell. A protein is made from amino acids linked together in a chain. These chains can then be folded into filaments or globules depending on the particular function of the protein. If this were an actual protein, the first four amino acids would be leucine, isoleucine, valine, and arginine based on the four code words or codons, CUC, AUC, GUC, and AGG. There are just 20 amino acids typically found in living things and 64 codons. Because of this, each amino acid has more than one codon. Leucine and arginine have six codons while most of the other amino acids have two or four codons. For this reason the code has frequently been referred to as "redundant" and the third letter of each codon was once thought to be "junk" since this letter in many of the codons does not affect the amino acid chosen by the cellular machinery.

Does this mean the genetic code is redundant or is there additional information in these codons? Codons that are similar to each other correspond to amino acids with similar chemical properties. In fact, the most used codons are those that, when mutated, keep on coding for the same amino acid or an amino acid that has similar chemical properties (Woese 1965; Willie and Majewski 2004). Leucine, with six different codons, CUC, CUA, CUU, CUG, UUA, and UUG, provides a good example of how base substitutions might not affect the amino acid sequence in a protein. A mutation in the DNA sequence resulting in an mRNA change in the third letter for four of the leucine codons starting with cytosine (C) would not change the amino acid sequence. For example, from the sequence above CUC-AUC-GUC-AGG, a mutation that changes the codon CUC to CUA would still place leucine at the beginning of the amino acid sequence. This type of mutation is referred to as a synonymous or neutral mutation causing no change in the protein sequence. A more interesting scenario would be if the first base in the second codon were changed from AUC to CUC. Leucine would substitute for isoleucine at the second position in this sequence. However, isoleucine, leucine, and valine all have very similar chemical properties and substituting these amino acids for each other might result in very minor changes in the structure and function of the affected protein. By contrast, arginine, an amino acid with quite different chemical properties from the other three in the example, also has a set of codons that are quite different. In most cases, it would take multiple mutations to change an arginine codon to a codon for one of the other three amino acids. The genetic code is arranged to minimize the affects of mistakes (mutations) in the synthesized protein and to reduce the occurrence of random changes in the organism.

cont'd

Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #782 on: March 01, 2007, 04:39:07 AM »

The code also has information that determines the amount and rate of protein production. To assemble a protein, mRNA codons are "read" by another nucleic acid, transfer RNA (tRNA), which in turn correctly aligns specific amino acids in the newly forming protein. For the codon CUC, tRNA attaches leucine to the amino acid sequence. Each tRNA bonds to mRNA with a complementary anti-codon (GAG in this case). If the protein being synthesized has several leucine amino acids, synthesis will go faster if the mRNA codons are CUC and there is a large population of tRNA with a GAG anti-codon. The rate of protein synthesis will be much slower if there are many CUC codons for leucine and few tRNAs with a GAG anti-codon. This preference is called codon usage bias. Proteins that are produced in large quantities by the cell have mRNA codons that match the most common tRNA anti-codons available (Ikemura 1985). Proteins that are in low concentration in the cell do not utilize the codon bias towards the most common tRNA species available and consequently, are synthesized at slower rates (Archetti 2004; Ikemura 1985). The codon usage bias helps to regulate the amount of a particular protein produced in the cell. Synonymous mutations in DNA that change an mRNA codon, but do not change the amino acid sequence, potentially can cause changes in the amount of a specific protein in a cell by altering the speed that these proteins are produced, consequently altering cellular functions.

Although the third base in many codons may not be important in determining the amino acid sequence, this position has information that affects the structure of mRNA (Shabalina, Ogurtsov, and Spiridonov 2006). Remember, the third letter in the leucine codons CUA, CUU, CUC, CUG, are synonymous sites, but each of these codons might produce different secondary structures. The mRNA secondary structure helps determine how long mRNA will last in the cell before being metabolized or degraded. The amount of protein a cell can make from mRNA is directly related to how long the mRNA persists in the cell. Synonymous mutations have been shown to affect the secondary structure and the decay rate of mRNA (Duan and Antezana 2003), which in turn affects how much of a specific protein is produced in the cell. Although the protein sequence is unaffected, altering the amount of a protein in the cell by changing mRNA secondary structure through "synonymous" mutations (CUA, CUU, e.g.) is associated with diseases in humans (Duan et al. 2003; Capon et al. 2004). These disorders emphasize the importance of maintaining the sequence integrity of the "redundant" third letter in the codon, and how changing it affects normal cellular functions.

The current data indicate that all of the bases in the genetic code are important for producing the correct protein in the appropriate amounts in the cell, and these are just a few of the examples of the information contained in the DNA code. It may be that when all of the information is deciphered from the genetic code, terms such a "synonymous," "neutral," and "redundant," will be obsolete. Just as Twain's wit and humor, in written form, is evidence of intelligence, the words of the genetic code are evidence of an Intelligent Author, and this Author of Life has loaded the genetic code with much information using little three-letter words!

Endnote

Quinn, a creationist, proposed a model of how a synonymous base substitution in mRNA (one that does not change the protein sequence), could alter the protein structure and consequently its function. Thirty-one years later, Kimchi-Sarfaty provided evidence of this actually occurring in a cell.

References

   1. Archetti, M. 2004. Selection on codon usage for error minimization at the protein level. J Mol Evol 59 (3):400-15.
   2. Capon, F. et al. 2004. A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups. Hum Mol Genet 13 (20):2361-8.
   3. Chamary, J. V., and L. D. Hurst. 2005. Evidence for selection on synonymous mutations affecting stability of mRNA secondary structure in mammals. Genome Biol 6 (9):R75.
   4. Duan, J., and M. A. Antezana. 2003. Mammalian mutation pressure, synonymous codon choice, and mRNA degradation. J Mol Evol 57 (6):694-701.
   5. Duan, J. et al. 2003. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet 12 (3):205-16.
   6. Ikemura, T. 1985. Codon usage and tRNA content in unicellular and multicellular organisms. Mol Biol Evol 2 (1):13-34.
   7. Kimchi-Sarfaty, C. et al. 2006. A "silent" polymorphism in the MDR1 gene changes substrate specificity. Science Express, December 21, 2006.
   8. Quinn, L. Y. 1975. Evidence for the existence of an intelligible genetic code. Creation Research Society Quarterly 11:188-198.
   9. Sanford, J. C. 2005. Genetic Entropy and the Mystery of the Genome. First ed. Lima, NY: Ivan Press.
  10. Shabalina, S. A. et al. 2006. A periodic pattern of mRNA secondary structure created by the genetic code. Nucleic Acids Res 34 (Cool:2428-37.
  11. Willie, E., and J. Majewski. 2004. Evidence for codon bias selection at the pre-mRNA level in eukaryotes. Trends Genet 20 (11):534-8.
  12. Woese, C. R. 1965. On the evolution of the genetic code. Proc Natl Acad Sci U S A 54 (6):1546-52.

*Dr. Daniel Criswell has a Ph.D. in molecular biology and is a biology professor at the ICR Graduate School.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #783 on: March 03, 2007, 09:01:04 PM »

Spear-chucking chimps

The scientific journal Current Biology reports chimpanzees in Senegal regularly fashion wooden spears and hunt other primates with them, an observation, the report's authors say, that could have implications for human evolution.

Let's assume, for a moment, that the observations of researchers Jill Pruetz and Paco Bertolani are accurate and unaffected by their own obvious faith in the evolutionary creed.

It doesn't surprise me in the least that chimps might make primitive, little spears. It was the evolutionary scientists who taught us a generation ago that the only difference between man and other animals was that we used tools. I never bought that either.

Personally, I think the difference between man and other animals is that we are made in the image of God. That's my belief. You don't have to agree with me, but I think there is considerably more evidence to support my view than the view that life arose spontaneously from non-life and then evolved into higher life forms.

But let's stick to the topic at hand – the spear-chucking chimps.

Let's try to imagine how a chimp with a stick might somehow fashion itself into another species – because that is ultimately what the authors of this report are suggesting.

How could that happen?

Of what consequence is the spear?

How might a weapon or a tool cause one species to change into another?

What changes at the molecular biological level occur when that primate picks up the sharpened stick?

Help me out here.

These are scientists. Why don't they explain what they mean?

The reason they don't explain is because there is no explanation.

Charles Darwin had no understanding of molecular biology. That's why he was free to speculate that if an animal flapped its arms long enough they might someday turn into wings – wings he could leave to his offspring. But today we know that's not the way molecular biology works.

Also, back in the days of Darwin, he was free to speculate that certain apes began using tools and became dominant over other apes. The survival of the fittest led to a new breed of apes – tool-using apes.

But the problem with that is you're still dealing with apes. How does the species transition into a new species? How does that happen? Where has that ever happened? How could it without one species dying out first?

Evolutionists don't have answers to these questions.

The DNA of that chimp doesn't change when he starts throwing a spear. The DNA of his descendant doesn't change either. You can go right down the line and the DNA of his grandchimps and great-grandchimps is still going to be the stuff of chimp DNA. It's not going to be another species. Behavior doesn't change molecular biology.

So what do you have after, say, 50 generations of spear-chucking chimps?

Maybe chimps that have perfected the art of spear-making and spear-chucking. But I guaranty for sure they are still chimps. Nothing has happened that could possibly affect their molecular structure – the very essence of what makes them chimps.

In fact, I'll go further. Let the evolutionists isolate these chimps and do whatever they want to them, change their environment, let them watch "Tarzan" movies, allow them to listen to self-empowerment CDs, permit them to interact with people. Do this for generations. You know what you will have when you're all done? Chimps.

You can teach them to ride bicycles. You can dress them up. You can even teach them to use some simple tools. But, at the end of the day, they're still going to be chimps. Their DNA will be no different, their molecular biology unaffected.

And, after that experiment, the people who believe in evolution are probably still going to believe in evolution. But, no matter what they believe, they can't change the fact that they, too, are made in the image of God.

Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #784 on: March 03, 2007, 09:28:17 PM »

Tool use by animals is nothing new although evolutionary scientists would like us to thin so. Following are just a few examples.

Benjamin Beck(1980) offers a fascinating story about the ingenuity of a crow which lived in his laboratory.  The crow was fed dried mash, which needs to be moistened before the crow can eat it.  However, the keepers occasionally forgot to do so.  The crow found a solution to his keepers' absent-mindedness; he used a cup to get water to moisten the mash himself!  The cup had been given to the crow as a toy but he used it to collect water from a trough on the other side of the room.

I was born and raised in corn country. An area where crows are prolific. I have seen many crows use tools in various manners to obtain food and to provide shelter for themselves. This does not mean that these crows are going to turn into humans tomorrow. They will still be crows.

Hungry Egyptian vultures use ingenuity in obtaining their food.  Since the shells of ostrich eggs are too hard to break open by simply pecking at them, the vultures use rocks to assist them.  According to reports by Jane Goodall from Tanzania, the vultures will search as far as 50 yards from the coveted egg in order to find a proper smashing tool.

The green heron drops a small object onto the surface of the water.  Fish swim to the surface, hoping that the object might be prey.  The heron then snatches the unsuspecting fish which come along to inspect its bait.

The woodpecker finch, residing on the Galapagos islands, is the most amazing of Darwin's finches.  Its talents include tool use as well as tool fabrication.  The finch is pries grubs out of a tree branch with a cactus spine.  A woodpecker's long barbed tongue enables it to extract grubs from branches without the assistance of a tool.  On the other hand, the woodpecker finch compensates for its short tongue by grasping a cactus spine in its beak and prying grubs out of the branch with the cactus spine.  The finch then drops the cactus spine and holds it under its foot while eating the grub.  The cactus spine is carried from branch to branch for reuse.

While manipulating poles in their play, the chimpanzees learned to use the poles to escape from their enclosure.  One chimp spontaneously utilized the pole in order to obtain something from a high shelf.  From the example of this chimp's use of the pole as a tool, the other chimps learned the use of the poles for escaping.  The group learning of these chimpanzees illustrates the importance of imitation in learning and tool use.  This behavior is included as tool use because, although it occurred in captivity, it was not the result of imitation or observation of human activity.

The researchers observed that the chimpanzees were very selective about the poles which they used as climbing tools.  They discarded old pieces of wood which might break, ones which were too long and cumbersome for carrying, and ones which were too short.  Chimps show sophisticated tool use in that they can modify objects to form tools.  For example, they have been observed joining two sticks together to make a longer tool for reaching high places.

Hooded monkeys demonstrate similar to those of the chimpanzees.  These monkeys were faced with the challenge of extracting yogurt from narrow plastic tubes.  The tubes were too small to probe with their fingers and were bolted to the table to prevent the monkeys from pouring out the contents.  The hooded monkeys cleverly fashioned spoons from pieces of wood which were available in the experiment room.

Indian Ocean bottlenose dolphins near Australia use sponges to help find food on the ocean floor. It is thought that they use sponges to protect their beaks while looking for food on the ocean floor.

Sea otters eat while floating on their backs. They often dive underwater to find a shellfish, then come up to the surface to eat it. They place a rock on their stomach and crack the shellfish against the rock to open it.

None of this is unusual and is fully expected. After all God has equipped all of His creatures to be able to to obtain food and necessary protection from the elements.

Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #785 on: March 14, 2007, 05:33:36 AM »

DINO HORNS HONKED FOR EVOLUTION according to and article in International
Business Times 8 Mar 2007. Michael Ryan, curator of vertebrate palaeontology at
the Cleveland Museum of Natural History has found a new horned dinosaur Alberta
Canada. The fossil is type of Ceratopsis - the horned dinosaurs. It has been
named "Albertaceratops nesmoi" after the region it was found in and a rancher
named Cecil Nesmo who has helped fossil hunters. Its horns are as thick as a
human arm, like those of triceratops, but it belongs to a subfamily that usually
has tiny horns. The fossil has been dated as being 78 million years old, which
puts in between the oldest horned dinosaur in North America, the Zuniceratops at
90 millions years old and riceratops around 68 million years. Because the new
fossil's horns are smaller than the older fossils, which has rally large horns
but larger than the small horned specimens that appear later, it is considered
to be an intermediate form in an evolutionary progression. Utah palaeontologists
Jim Kirkland, who found the large horned Zuniceratops predicted that something
like the new horned fossil would be found. He commented: "low and behold,
evolutionary theory really works.'

ED.COM. Let's think about this argument: first they found Dino "long-horns,"
then they found Dino "short-horns", then somebody guessed there should be Dino
"in-between-horns," and now that they have found it, this is proof evolution
theory works? Truly amazing! This editor has seen Texas longhorn cows, Illawara
short horned cows, and mid-sized horned Friesians, (even some polled cows with
no horns)- all in the same enclosure at the Royal Agricultural show, and to
think I and didn't recognize the proof of evolution.

_____________________

This is really stretching things. Anyone that has been around horned animals surely must be able to laugh in the face of those that came up with this. Talk about unscientific statements this one really tops the cake.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #786 on: March 29, 2007, 05:55:22 PM »

..... but they are working hard to cover their tracks with another evolutionary theory.

__________________


Study Re-evaluates Evolution of Mammals

The mass extinction that wiped out dinosaurs and other life 65 million years ago apparently did not, contrary to conventional wisdom, immediately clear the way for the rise of today’s mammals.

In fact, the ancestral branches of most mammals, including primates, rodents and hoofed animals, emerged long before the global extinction and survived it more or less intact. But it was not until at least 10 million to 15 million years afterward that the lineages of living mammals began to flourish in number and diversity.

Some mammals did benefit from the extinction, but these were not closely related to extant lineages and most of them soon died off.

These are the surprising conclusions of a comprehensive study of molecular and fossil data on 4,510 of the 4,554 mammal species known to exist today. The researchers are to report the findings in Thursday’s issue of the journal Nature, and they said this is the first virtually complete species-level study of existing mammals.

Writing in the journal, the leaders of the project said the “fuses” leading to the explosive expansion of mammals “are not only very much longer than suspected previously, but also challenge the hypothesis that the end-Cretaceous mass extinction event had a major, direct influence on the diversification of today’s mammals.”

They said their analysis of more than 40 lineages of existing mammals showed that diversification rates “barely changed” in the aftermath of the extinctions at the boundary of the Cretaceous and Tertiary periods. The transforming changes started 10 million years later and lasted until about 35 million years ago.

Other scientists said the so-called “long-fuse model” opened a door to a better understanding of the evolutionary history of mammals and will force a re-examination of the ecological and other causes underlying the more recent proliferation of mammals.

The international team that produced the new “supertree” of mammalian evolution was led by Olaf R. P. Bininda-Emonds of the Technical University of Munich in Germany and Andy Purvis of Imperial College in London. Other members included paleontologists, mammalogists, evolutionary biologists and other researchers from Australia, Canada and the United States.

In another article in Nature, David Penny and Matthew J. Phillips of Massey University in New Zealand, who were not involved in the research, wrote, “Inferring a good tree of such scale is groundbreaking, and the methods will be used as a model for tree-of-life studies — whether of birds, flowering plants, invertebrate groups or other organisms.”

They also noted that a similar analysis for birds, published recently in the journal Biology Letters, revealed that more than 40 avian lineages survived the mass extinctions. Most paleontologists now think that birds descended from dinosaurs. So in a sense, even dinosaurs in one form escaped the calamity.

Until now, however, most paleontologists had favored a “short-fuse” model in which mammals came into their own almost immediately after the dominant reptiles vacated their habitats. Before the extinctions, most mammals were small nocturnal creatures.

The new study confirmed and elaborated on earlier research by molecular biologists indicating that many of today’s mammalian orders originated from 100 million to 85 million years ago. The reasons for this evolutionary burst are not clear.

Drawing on both molecular and fossil data, the researchers said they found that the “pivotal macroevolutionary events for those lineages with extant mammalian descendants” occurred well before the mass extinction and long after. They emphasized that the molecular and fossil evidence provide “different parts of this picture, attesting to the value of using both approaches together.”

But the researchers conceded that much more research would be required to explain “the delayed rise of present-day mammals.”

Ross D. E. MacPhee, a curator of vertebrate zoology at the American Museum of Natural History who was a team member, said that paleontologists were previously dubious of the claims by molecular biologists of such an early ancestry of today’s mammals. The fossil record of mammals in the Cretaceous period, they contended, was too sparse to support such an interpretation.

“Now we know the ancestors of living mammal groups were there, but in very low numbers,” Dr. MacPhee said.

“The big question now is what took the ancestors of modern mammals so long to diversify,” he continued. “Evidently we know very little about the macroecological mechanisms that play out after mass extinctions.”

_________________________

The whole reason for this re-evaluation is because the fossil record clearly shows mammals existing at the same time as dinosaurs. This group is still denying the time frame, other fossil data proving all mammals and humans existing with dinosaurs, and global flood data.

As is always the case evolutionary theorists have to continually change their data in an attempt to make evidence fit their theory. All this does is to solidify the story of Creation and Noah's flood. A story that has no need to change to fit fossil data.

« Last Edit: March 29, 2007, 10:14:22 PM by Pastor Roger » Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #787 on: April 01, 2007, 07:07:14 PM »


Does the Phrase "Evening and Morning" Help Define "Day"?
by John Morris, Ph.D.*

The length of the days of Genesis 1 has been much debated. Are the days of Genesis 1 regular solar days, referring to the rotation of the earth on its axis, or could each day be a long, indefinite period of time, equivalent in total to the vast time spans of geology? Such an interpretation would give solace to Christians who try to harmonize long ages with Genesis.

It is true that the Hebrew word yom,translated "day," can have a variety of meanings. By far its most common is a literal day, but it can mean "age." The question is, what does it mean here? As always for a word with multiple possible meanings, we must let the Scriptural context take precedence in discerning its meaning for a particular usage.

Interestingly, the very first time the word is used, in Genesis 1:5, it is strictly defined as the light portion of a light/dark cycle as the earth rotated underneath a directional light source, producing day and night. It is also true that whenever "day" is modified by a number, like second day or six days, it can only mean a true solar day. There are no exceptions in Hebrew. Any uncertainty is resolved in the Ten Commandments as God commands us to work six days and rest one day just as He worked on the six creation days and rested on day seven (Exodus 20:11).

Now consider that each day in Genesis is modified by the term "evening and morning," both commonly used words in the Old Testament. Can they be referring to indefinite periods of time? Standard Bible study tools define the Hebrew word for "evening" (ereb) as meaning simply evening or night. It is derived from expressions connoting "the setting of the sun or sunset," and associated with evening sacrificial meal and rituals. Often mentioned is the "evening sacrifice" or "returning at evening." Likewise the word for "morning" (bôqer) literally means morning or dawn, the breaking through of daylight, and reference is made to "rising early in the morning" or keeping the fire burning until the morning. There is little possibility of translating the word pair as "the end of an age" and/or "the beginning of an age."

The job of both Bible student and expositor is to carefully determine what the Author of Scripture is communicating to the reader. We dare not impose on the straightforward Word of God our own bias. We must stand in submission to Him and His words. Remember, God is all wise and wants to reveal truth to us, things we might not know otherwise. He can also write clearly. He will help us understand even difficult passages if we value His thoughts above our own.

*Dr. John D. Morris is the President of the Institute for Creation Research.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #788 on: April 01, 2007, 07:08:50 PM »


Follow the Evidence!
by Frank Sherwin, M.A.*

Charles Darwin was a good naturalist (biologist) who did work in a variety of areas such as plant hormones and barnacles. But when it came to fossils (physical evidence) documenting macroevolution, he knew they argued against his idea. In fact, one chapter in his 1859 book is entitled, "On the Imperfection of the Geologic Record."

What Darwin did was profoundly unscientific. He decided to ignore the physical evidence (the fossil record) and hold tightly to his unproved, unobserved theory of descent with modification: macroevolution. Scientists don't normally do this, but Darwin felt that through time research would vindicate this strange position. In fact, just the opposite has occurred.1 The missing links are still missing.

Things haven't changed that much in secular science. The philosophy of Darwinism has prevented many from viewing clear physical evidence and making an unbiased determination based on that evidence. This was graphically displayed recently when "70-million-year-old" soft dinosaur tissue was unearthed in eastern Montana. Indeed, National Geographic News admitted many dinosaur fossils could have soft tissue inside.2 It is obvious that organic tissue cannot maintain such pristine condition through enormous time spans. The only alternative is that the tissue and surrounding fossilized material is quite young -- which is anathema to the secular scientist who insists on an old earth. The philosophical convictions of these scientists will not allow them to go where the physical evidence leads:

    I believe a philosophical framework is not something that can be eliminated in order to provide "objectivity." In my view, "objectivity" does not exist in science. Even in the act of gathering data, decisions about what data to record and what to ignore reflect the philosophical framework of the scientist.3

Discover magazine ran an article regarding Dr. Mary Schweitzer's phenomenal soft dinosaur tissue discovery. She stated,

    I had one reviewer tell me he didn't care what the data said, he knew that what I was finding wasn't possible. I wrote back and said, "Well, what data would convince you?" And he said, "None."4

How would the secular community respond if a creation scientist said such a thing? Scientists of all stripes should go where the evidence leads.

    As the result of the impact of what T. H. Huxley once called "one ugly little fact," the truly scientific investigator will make whatever changes are demanded by the situation, even if he is compelled to begin his research de novo to all intents and purposes.5

   1. Swift, D. 2002. Evolution under the microscope. Stirling, Scotland: Leighton Academic Press.
   2. Norris, S. 2006. Many dino fossils could have soft tissue inside. National Geographic News. February 22.
   3. Wolpoff, M. 1999. Paleoanthropology. 2nd ed., Boston, MA: McGraw-Hill, lv.
   4. Yeoman, B. 2006. Schweitzer's dangerous discovery. Discover, April: 37.
   5. Harrison, R. K. Introduction to the Old Testament. Peabody, MA: Hendrickson Publishers, 508. (As cited from Josh McDowell's book, The New Evidence that Demands a Verdict. San Bernardino, CA: Here's Life Publishers, 1999: 409.)

*Frank Sherwin is a zoologist and seminar speaker for ICR.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #789 on: April 05, 2007, 10:42:19 AM »

SEA LEVEL SCEPTICISM reported in news.com.au. After viewing an Australian
Museum display of the changing coastline around Sydney Piers Akerman, writing
for the Sunday Telegraph, claims "climate doomsayers are all at sea". According
to the Museum, 18,000 years ago the coastline was 15 km (9.3 miles) to the east
and 120 metres (394ft) below the current sea level. This means there was no
Sydney Harbour, just a long series of sandy beaches with few headlands and no
extensive rock platforms. Between 18,000 and 6,000 years ago the sea levels rose
to their current levels. This is a rise, on average, of one metre (3ft 3in)
every 100 years. Piers Akerman comments: "But the worst-case scenario posed by
the Intergovernmental Panel on Climate Change . has sea level rising about 0.3m
per 100 years, about a third of the rise known to have occurred in the
relatively recent past." He then goes to ask how they know the current changes
in sea level and climate are caused by human activity. During the time of rapid
sea level rise described in the Australian Museum display, human technology is
believed to have been "fire-stick farming," hunting and gathering, and cooking
over camp fires.

ED. COM. We may not agree with the timetable presented by the Australian Museum,
but there is no doubt that sea levels and climate have changed significantly in
the past and are continuing to do so. Piers Ackerman is asking the right
question - if there weren't millions of people burning coal and oil when the sea
levels were rising at a more rapid rate than they are today, why do we blame
mankind for the recent slower changes? The Bible tells us that large variations
in the world's climate began with the world wide flood of Noah. When it was
over, God told Noah that for the rest the history of the world there would be
periods of cold and heat, and 4,000 years of agricultural history has confirmed
this. Of course, it is harder to shift the Sydney opera house than an Aboriginal
Gunya made of sticks.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #790 on: April 05, 2007, 10:43:20 AM »

COLLEGE GRADUATES REJECT EVOLUTION, according to Newsweek poll published 30
Mar 2007. The poll found that 48% of the USA general public rejects the theory
of evolution and 34% of college graduates claimed to accept the Biblical account
of creation as a fact. The poll also collected statistics on overall religious
allegiances. Atheists accounted for only nine % of people in the poll. The
remaining 91% believed in a god/God and 82% identified themselves as Christians.
The other five % identified themselves with non-Christian religions, such as
Judaism or Islam. Of those who identified themselves as Evangelical Protestants,
73% claimed they believed God created human beings in their present form, less
than 10,000 years ago. This belief was also held by 39% of non-Evangelical
Protestants and 41% of Catholics.


ED. COM. TWO PERSPECTIVES ON THIS ONE:
1.) We suspect that militant atheists like Richard Dawkins will be pouring scorn
on these results, but they are similar to results of a BBC Mori poll survey in
Britain in 2006, which showed that only 48 % of people believed evolution was
the best explanation for how the world got here, and 39 % believed in creation
or intelligent design. (See "Evolution fails in British opinion poll, Evidence
News 8 Feb 2006) Despite evolutionists' and atheists' almost complete dominance
of professional and popular media in both countries, a significant number of
people believe the Bible gives a better explanation of how they got here.
Whether they have a college education or not, people know from their own
experience that chance random processes only destroy things. It takes a Creator
to make a functioning world.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #791 on: April 05, 2007, 10:46:03 AM »

HISSING LINK? asks Nature, vol 446, p473 29 Mar 2007. Palaeontologist Michael
Caldwell of the University of Alberta and Alessandro Palci of the University of
Modena, Italy have studied a fossil lizard found in Slovenia and claim they have
found clues as to how lizards evolved into snakes. The creature has been named
"Adriosaurus microbrachis" and has a small head and a long neck and body. Its
forelimbs are "greatly reduced", i.e. it does not have forearm bones, hands or
digits. In an article from the Eureka Alert news service Caldwell comments: "For
some oddball reason the forelimbs were lost before the rear limbs when you would
think it would be the opposite. The front limbs would be useful for holding onto
dinner or digging a hole but it must be developmentally easier to get rid of the
forelimbs." Dr. Martin Cohn, from the Department of Zoology and University of
Florida Genetics Institute commented: "This is a terrifically important
discovery because it shows, in a group of animals thought to be closely related
to snakes, that forelimb reduction and trunk elongation were well underway
before the onset of hindlimb reduction. By uncovering the sequence of the
morphological changes that occurred during evolution of a snake-like body plan,
Palci and Caldwell's study provides important clues as to which developmental
mechanisms could have been involved." The Eureka alert article also comments:
"Living lizards also show almost every variation in limb reduction from a
perfectly formed back limb with no forelimb, or a spike for a forelimb and one
or two toes on the rearlimb, to total limblessness. This degree of variation
makes it very difficult to understand the pattern of evolutionary limb loss in
these animals."

ED. COM. The best explanation for the fossil described above is that genes for
lizard limb formation have been damaged and some lizards no longer develop
normal limbs. This is not evolution, it is degeneration. Loss of structures in
both fossil and living creatures is good evidence for the Biblical history of
life. Genesis tells us that God made fully functioning creatures in separate
kinds to live and reproduce in a very good world. Since then the world's
environment has degenerated because of human sin and God's judgement, and
radiation and chemicals have damaged the genes of many animals. In addition we
can add, If living lizards show "almost every variation in limb reduction," then
finding a fossil lizard showing one of these variations cannot be considered
evidence that lizards turned into snakes millions of years ago
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #792 on: April 05, 2007, 10:49:50 AM »

FOR BBC POT LUCK ON EVOLUTION vs CREATION as anti creationist Eugenie C.
Scott from National Center for Science Education (USA) featured in a BBC World
Service "Heart and Soul" program March 25, 2007, the first of a two-segment
feature on religious views regarding creationism and evolution. Scott
interviewed atheist Richard Dawkins, non-theistic cosmologist Paul Davies,
old-earth creationist Hugh Ross of Reasons to Believe, theistic evolutionist and
Lutheran theologian Ted Peters from Pacific School of Religion, and Ken Ham of
Answers in Genesis USA. In the second segment, Henry M. Morris III of the
Institute for Creation Research was the interviewer, and met with Scott on the
edge of the Grand Canyon to discuss their experiences. Morris's programme is on
the link below until the next programme is broadcast Sunday 8th April." It is
unclear whether both segments will be permanently archived.

ED.COM. Note that in his interview Dawkins claims that the fossil evidence is no
longer needed to support evolution "we have enough evidence from genetics".
Seems he has not discussed it with UK's Dr Steve Jones whom we debated last year
on the BBC and who said "The finest evidence of evolution comes from fossils."
Dr Steve Jones Royal Society Lecture, 11 April 2006. "Why creationism is wrong
and evolution is right" - Prof Steve Jones 29 Min. 14 Sec. Into Podcast
available from Royal Society web site. Sadly both programmes suffered from
'reporters' being extremely polite to people they disagreed with - overworking
it in fact.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #793 on: April 05, 2007, 10:51:10 AM »

TRANSITIONAL FOSSILS QUERY as Canadian asks "what do we say to claims on
"Transitional Vertebrate Fossils FAQ Part 1B"
http://www.talkorigins.org/faqs/faq-transitional/part1b.html Copyright C
1994-1997 by Kathleen Hunt
http://www.talkorigins.org/faqs/faq-transitional/email.html She wrote in
Species-to-species transition, referring to a set of numerous individual
fossils, "that show a change between one species and another. It's a very
fine-grained sequence documenting the actual speciation event, usually covering
less than a million years. These species-to-species transitions are unmistakable
when they are found. Throughout successive strata you see the population
averages of teeth, feet, vertebrae, etc., changing from what is typical of the
first species to what is typical of the next species. Sometimes, these sequences
occur only in a limited geographic area (the place where the speciation actually
occurred), with analyses from any other area showing an apparently "sudden"
change. Other times, though, the transition can be seen over a very wide
geological area. Many 'species-to-species transitions' are known, mostly for
marine invertebrates and recent mammals (both those groups tend to have good
fossil records), though they are not as abundant as the general lineages (see
below for why this is so). Part 2 lists numerous species-to-species transitions
from the mammals."

ED.COM. This comment is not new, but it has been turned into more of a lie now
than it was when this editor was a geology student at University. The guru in my
student days was George Gaylord Simpson who said the same thing, but went on to
qualify it, and then deny his qualification in order to support evolution.

George Gaylord Simpson (evolutionist), wrote in The Major Features of Evolution,
New York, Columbia University Press, 1953 p. 360.

(HIS STATEMENT OF TRUTH) "In spite of these examples, it remains true, as every
paleontologist knows, that most new species, genera, and families and that
nearly all new categories above the level of families appear in the record
suddenly and are not led up to by known, gradual, completely continuous
transitional sequences."

(HIS QUALIFICATION) "When paleontological collection was still in its infancy
and no clear examples of transitional origin had been found, most
paleontologists were anti-evolutionists. Darwin (1859) recognized the fact that
paleontology then seemed to provide evidence against rather than for evolution
in general or the gradual origin of taxonomic categories in particular."

(HIS DENIAL OF THE FIRST TRUTH) "Now we do have many examples of transitional
sequences."

(HIS REASON FOR NOT LISTING ANY EXAMPLES) "Almost all paleontologists recognize
that the discovery of a complete transition is in any case unlikely. Most of
them find it logical, if not scientifically required, to assume that the sudden
appearance of a new systematic group is not evidence for special creation or for
saltation, but simply means that a full transitional sequence more or less like
those that are known did occur and simply has not been found in this instance."
END OF QUOTE.

THEN ALONG CAME GOULD, ELDRIGE AND the professor of Geology at my old Uni, Prof
Waterhouse, who used the very real gaps to demand a new theory of evolution
called punctuated evolution. Which brings us to the FACTS AT PRESENT: There are
plenty of transitional forms, living and fossil, if you are trying to explain
how Finch species 1 became Finch species 2. BUT Genesis is not about the origin
of species, it is about the origin of separate Kinds. That's why Gould could
make a good case for punctuation based on real gaps in the fossil record which
do not support Darwinism, and it's also why we Creation Researchers win debates
against evolutionists.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Soldier4Christ
Global Moderator
Gold Member
*****
Offline Offline

Posts: 61552


One Nation Under God


View Profile
« Reply #794 on: April 05, 2007, 10:52:32 AM »

COD STAY SHRUNK, according to an article in ScienceNOW 31 Jan 2007. After
years of over-fishing Atlantic cod became smaller in both size and numbers. A
moratorium was declared on catching Atlantic cod in 1993 in the hope that the
population and the average size of fish would bounce back. However, this has not
happened. Douglas Swain, a biologist at the Gulf Fisheries Centre, Moncton,
Canada has studied 20 years of records from 1977 to 1997 of fishing intensity,
fish size and population and environmental variables such as temperature. During
this time there was abundant food for the fish, and the temperatures were warm
enough for them to grow to larger sizes. Swain's team concluded that the current
generation of fish has inherited a slow growth rate from previous generations of
slow growing fish which would have reached reproductive age before being caught.

The ScienceNOW article summarised the findings as: "Researchers report that
because the largest and fastest growing fish were harvested, cod have evolved to
grow slowly - an adaptation that haunts them to this day."

ED. COM. This study provides one insight into possible reasons for the decrease
in size of many present day animals when compared with their fossils. When human
beings began to hunt animals after Noah's flood they would have seen and killed
the larger animals first. Therefore, smaller animals that had reached
reproductive age before they were killed off would be more likely to have left
offspring before they died. Therefore, with each generation the slow-growers
would survive and eventually be the only ones left. This is a change brought
about by selection, but it is not evolution. The genes for slow growth already
existed, and removing the genes for rapid growth decreases the overall genetic
potential of the population. This fish study also adds to the overwhelming
evidence that the world is going downhill, not evolving upwards, just as the
Bible describes.
Logged

Joh 9:4  I must work the works of him that sent me, while it is day: the night cometh, when no man can work.
Pages: 1 ... 51 52 [53] 54 55 ... 85   Go Up
  Print  
 
Jump to:  

Powered by MySQL Powered by PHP Powered by SMF 1.1 RC2 | SMF © 2001-2005, Lewis Media Valid XHTML 1.0! Valid CSS!